{
  "abstract": "Guanine (G)‐rich nucleic acid sequences, capable of folding into G‐quadruplex (G4), are widely distributed in functionally important genomic regions and play key roles in DNA replication. Origin G‐rich repeated elements (OGRE) have been identified at replication origins in mouse, Drosophila, human and chicken. However, G4 structures formed by OGRE remain poorly understood. Here, we report the first high‑resolution G4 structure formed by OGRE from the β‐globin replication origin of chicken (Gallus gallus). The 23 nt DNA sequence d[GGGAACGCGGCATCAGGGTGGGG], termed ChOGRE23, folds into an intramolecular three‐layer (3+1) hybrid G4 containing a cytosine bulge. Notably, the 5'‐end guanine participating in the outermost G‐quartet adopts an anti glycosidic conformation, representing a previously unobserved glycosidic alignment in unimolecular (3+1) hybrid G4s. Together with the cytosine bulge, these unusual structural features create a distinct molecular surface that may facilitate selective recognition by replication‑associated proteins or small molecules.",
  "abstract_shown": true,
  "affiliations": [
    "Department of Otorhinolaryngology Head and Neck Surgery, the Eighth Affiliated Hospital Sun Yat‐sen University Shenzhen China",
    "Division of Life Science The Hong Kong University of Science and Technology Hong Kong China",
    "Fujian Key Laboratory of Brain Tumors Diagnosis and Precision Treatment, Xiamen Key Laboratory of Brain Center, Clinical Research Institute of the First Affiliated Hospital of Xiamen University, the First Affiliated Hospital of Xiamen University, School of Medicine, School of Public Health Xiamen University Xiamen Fujian China",
    "HKUST Shenzhen Research Institute, Hi‐Tech Park Shenzhen China",
    "Department of Chemistry The Hong Kong University of Science and Technology Hong Kong China",
    "School of Life Sciences and the Centre for Soybean Research of the State Key Laboratory of Agrobiotechnology The Chinese University of Hong Kong Hong Kong China",
    "Department of Anatomical and Cellular Pathology, Prince of Wales Hospital, State Key Laboratory of Translational Oncology, Sir YK Pao Centre For Cancer The Chinese University of Hong Kong Hong Kong China",
    "Institute For Advanced Study and State Key Laboratory of Molecular Neuroscience The Hong Kong University of Science and Technology Hong Kong China"
  ],
  "article_type": "research article",
  "arxiv": null,
  "author_total": 14,
  "authors": [
    {
      "affs": [
        0
      ],
      "name": "Yingying You",
      "orcid": "0000-0002-1044-4452"
    },
    {
      "affs": [
        1
      ],
      "name": "Monica Ching Suen"
    },
    {
      "affs": [
        1
      ],
      "name": "Haitao Miao"
    },
    {
      "affs": [
        2
      ],
      "name": "Yanyan Geng"
    },
    {
      "affs": [
        1
      ],
      "name": "Rahman Ud Din"
    },
    {
      "affs": [
        1
      ],
      "name": "Mu Yuan"
    },
    {
      "affs": [
        1
      ],
      "name": "Qiang Xue"
    },
    {
      "affs": [
        1
      ],
      "name": "Xiaoting Li"
    },
    {
      "affs": [
        1,
        3
      ],
      "name": "Naining Xu"
    },
    {
      "affs": [
        4
      ],
      "name": "Zhihong Guo"
    },
    {
      "affs": [
        5
      ],
      "name": "Hon‐Ming Lam",
      "orcid": "0000-0002-6673-8740"
    },
    {
      "affs": [
        6
      ],
      "name": "Kwok‐Wai Lo"
    },
    {
      "affs": [
        1,
        3
      ],
      "name": "Changdong Liu"
    },
    {
      "affs": [
        1,
        3,
        7
      ],
      "name": "Guang Zhu"
    }
  ],
  "bibtex": "https://research.draconitic.com/paper/0d4j4q6yaaekh.bib",
  "cited_by": 0,
  "doi": "10.1002/chem.71389",
  "fulltext_url": "https://pmc.ncbi.nlm.nih.gov/articles/PMC13715453/",
  "id": "0d4j4q6yaaekh",
  "issns": [
    "0947-6539",
    "1521-3765"
  ],
  "landing_url": "https://doi.org/10.1002/chem.71389",
  "language": "en",
  "licence": "CC-BY-4.0",
  "licence_label": "CC BY 4.0",
  "licence_source": "article",
  "licence_url": "https://creativecommons.org/licenses/by/4.0/",
  "metadata_licence": null,
  "native_subjects": [
    [
      "heading",
      "Research Article"
    ],
    [
      "openalex",
      "1312|DNA and Nucleic Acid Chemistry"
    ]
  ],
  "openalex": "W7168411222",
  "pdf_url": null,
  "pmcid": "PMC13715453",
  "pmid": "42454973",
  "published": "2026-07-15",
  "publisher": null,
  "ris": "https://research.draconitic.com/paper/0d4j4q6yaaekh.ris",
  "sources": [
    {
      "first_seen": "2026-11-01T12:22:45Z",
      "native_id": "PMC13715453",
      "source": "pmc",
      "url": "https://doi.org/10.1002/chem.71389"
    }
  ],
  "subjects": [
    {
      "field": "biochemistry",
      "origin": "openalex:1312|DNA and Nucleic Acid Chemistry",
      "subfield": "molecular-biology"
    }
  ],
  "title": "A Cytosine‑Bulged (3+1) Hybrid G‑Quadruplex Formed by the Chicken DNA Replication Origin",
  "title_text": "A Cytosine‑Bulged (3+1) Hybrid G‑Quadruplex Formed by the Chicken DNA Replication Origin",
  "type": "peer-reviewed",
  "updated_at": "2026-11-01T12:22:45Z",
  "url": "https://research.draconitic.com/paper/0d4j4q6yaaekh",
  "venue": "Chemistry (Weinheim an Der Bergstrasse, Germany)",
  "versions": []
}