Skip to content
DraconiticResearch
Search Sources API
203,203 studies31 sourcesUpdated 18 min ago
Peer-reviewedCC BY 4.0Chemistry (Weinheim an Der Bergstrasse, Germany)

A Cytosine‑Bulged (3+1) Hybrid G‑Quadruplex Formed by the Chicken DNA Replication Origin

  • Yingying You1
  • Monica Ching Suen2
  • Haitao Miao2
  • Yanyan Geng3
  • Rahman Ud Din2
  • Mu Yuan2
  • Qiang Xue2
  • Xiaoting Li2
  • Naining Xu2,4
  • Zhihong Guo5
  • Hon‐Ming Lam6
  • Kwok‐Wai Lo7
2 more authors
  • Changdong Liu2,4
  • Guang Zhu2,4,8
8 affiliations
  1. 1Department of Otorhinolaryngology Head and Neck Surgery, the Eighth Affiliated Hospital Sun Yat‐sen University Shenzhen China
  2. 2Division of Life Science The Hong Kong University of Science and Technology Hong Kong China
  3. 3Fujian Key Laboratory of Brain Tumors Diagnosis and Precision Treatment, Xiamen Key Laboratory of Brain Center, Clinical Research Institute of the First Affiliated Hospital of Xiamen University, the First Affiliated Hospital of Xiamen University, School of Medicine, School of Public Health Xiamen University Xiamen Fujian China
  4. 4HKUST Shenzhen Research Institute, Hi‐Tech Park Shenzhen China
  5. 5Department of Chemistry The Hong Kong University of Science and Technology Hong Kong China
  6. 6School of Life Sciences and the Centre for Soybean Research of the State Key Laboratory of Agrobiotechnology The Chinese University of Hong Kong Hong Kong China
  7. 7Department of Anatomical and Cellular Pathology, Prince of Wales Hospital, State Key Laboratory of Translational Oncology, Sir YK Pao Centre For Cancer The Chinese University of Hong Kong Hong Kong China
  8. 8Institute For Advanced Study and State Key Laboratory of Molecular Neuroscience The Hong Kong University of Science and Technology Hong Kong China
Read full textDOICite

Abstract

Guanine (G)‐rich nucleic acid sequences, capable of folding into G‐quadruplex (G4), are widely distributed in functionally important genomic regions and play key roles in DNA replication. Origin G‐rich repeated elements (OGRE) have been identified at replication origins in mouse, Drosophila, human and chicken. However, G4 structures formed by OGRE remain poorly understood. Here, we report the first high‑resolution G4 structure formed by OGRE from the β‐globin replication origin of chicken (Gallus gallus). The 23 nt DNA sequence d[GGGAACGCGGCATCAGGGTGGGG], termed ChOGRE23, folds into an intramolecular three‐layer (3+1) hybrid G4 containing a cytosine bulge. Notably, the 5'‐end guanine participating in the outermost G‐quartet adopts an anti glycosidic conformation, representing a previously unobserved glycosidic alignment in unimolecular (3+1) hybrid G4s. Together with the cytosine bulge, these unusual structural features create a distinct molecular surface that may facilitate selective recognition by replication‑associated proteins or small molecules.

Related

  1. The function of human PIF1 in G quadruplex formation and replication stress response at ALT telomeres
    A. Ragupathi, R. Zhao, S. Najit +18
    bioRxivPreprintCC BYFull textMolecular biology & gene regulationbioRxiv
  2. Cytosine-Rich DNA Aptamers Reveal Recognition Principles for Structurally Diverse Lipopolysaccharides.
    Atsuro Tatsumi, Natsuka Koyama, Makoto Yamashita
    ACS measurement science auPeer-reviewedCC BY-NC-NDFull textMolecular biology & gene regulationEurope PMC
  3. DNA Polymerase Catalyzes Successive Formation of Cytosine-AgI-Thymine Base Pairs
    Tatsuya Funai, Keiko Morita, Ayaka Tani +2
    Chemical and Pharmaceutical BulletinPeer-reviewedCC BY-NCFull textMolecular biology & gene regulationJ-STAGE
  4. Chapter 14: Unwinding Quadruplex Structures with RNA Helicases
    John C. Marecki, Jun Gao, Kevin D. Raney
    Methods in molecular biology (Clifton, N.J.)Peer-reviewedLicence not statedFull textMolecular biology & gene regulationPMC
  5. Cytoplasmic recapping commences the translation of a micropeptide, MARS from MALAT1 after the removal of an inhibitory RNA G-quadruplex
    A. Mukherjee, R. Sonar, P. P. Mishra +2
    bioRxivPreprintAll rights reservedFull textMolecular biology & gene regulationbioRxiv

Cite

BibTeXRIS
BibTeX
@article{you2026cytosinebulged,
  title = {{A Cytosine‑Bulged (3+1) Hybrid G‑Quadruplex Formed by the Chicken DNA Replication Origin}},
  author = {Yingying You and Monica Ching Suen and Haitao Miao and Yanyan Geng and Rahman Ud Din and Mu Yuan and Qiang Xue and Xiaoting Li and Naining Xu and Zhihong Guo and Hon‐Ming Lam and Kwok‐Wai Lo and Changdong Liu and Guang Zhu},
  journal = {Chemistry (Weinheim an Der Bergstrasse, Germany)},
  year = {2026},
  month = jul,
  doi = {10.1002/chem.71389},
  url = {https://doi.org/10.1002/chem.71389},
  note = {CC BY 4.0},
}
RIS
TY  - JOUR
TI  - A Cytosine‑Bulged (3+1) Hybrid G‑Quadruplex Formed by the Chicken DNA Replication Origin
AU  - Yingying You
AU  - Monica Ching Suen
AU  - Haitao Miao
AU  - Yanyan Geng
AU  - Rahman Ud Din
AU  - Mu Yuan
AU  - Qiang Xue
AU  - Xiaoting Li
AU  - Naining Xu
AU  - Zhihong Guo
AU  - Hon‐Ming Lam
AU  - Kwok‐Wai Lo
AU  - Changdong Liu
AU  - Guang Zhu
PY  - 2026
DA  - 2026/07/15
JO  - Chemistry (Weinheim an Der Bergstrasse, Germany)
DO  - 10.1002/chem.71389
UR  - https://doi.org/10.1002/chem.71389
AB  - Guanine (G)‐rich nucleic acid sequences, capable of folding into G‐quadruplex (G4), are widely distributed in functionally important genomic regions and play key roles in DNA replication. Origin G‐rich repeated elements (OGRE) have been identified at replication origins in mouse, Drosophila, human and chicken. However, G4 structures formed by OGRE remain poorly understood. Here, we report the first high‑resolution G4 structure formed by OGRE from the β‐globin replication origin of chicken (Gallus gallus). The 23 nt DNA sequence d[GGGAACGCGGCATCAGGGTGGGG], termed ChOGRE23, folds into an intramolecular three‐layer (3+1) hybrid G4 containing a cytosine bulge. Notably, the 5'‐end guanine participating in the outermost G‐quartet adopts an anti glycosidic conformation, representing a previously unobserved glycosidic alignment in unimolecular (3+1) hybrid G4s. Together with the cytosine bulge, these unusual structural features create a distinct molecular surface that may facilitate selective recognition by replication‑associated proteins or small molecules.
SN  - 0947-6539
SN  - 1521-3765
ER  -